EST details — SGN-E279995

Search information 
Request: 279995Match: SGN-E279995
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60175Clone name: cLEL-7-G7
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60175 [cLEL-7-G7] Trace: SGN-T18491 EST: SGN-E237127 Direction: 3' Facility: Cereon
Clone: SGN-C60175 [cLEL-7-G7] Trace: SGN-T18646 EST: SGN-E237282 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279995Length: 414 bp (587 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279995 [] (trimmed) CGGCACGAGCTTCTCGCCGCGCTTTATCATCGTTCAATTTTGACTAGATTAAGCGATCGAAGATGTTTGGGACGGCACCGAAAAAGAGCGACAAC
ACGAAGTACTATGAAATCTTAGGTGTTCCTAAAACTGCTGCACAAGAAGATCTCAAGAAAGCTTACCGTAAAGCTGCTATTAAGAATCATCCTGA
TAAGGGAGGTGATCCTGAAAAGTTTAAAGAGCTTGCACAAGCTTATGAGGTTCTGAGTGATCCCGAGAAGCGTGAGATATATGATCAGTATGGAG
AAGATGCTCTCAAGGAAGGAATGGGCGGTGGAGGTGGTGGACACGACCCATTTGATATTTTCTCATCTTTCTTTGGTGGCAGCCCATTTGGTGGA
CGTGGTGTGAAGCAGCAGAAGAAGAAGACCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279995] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22366 [Download] [View] Facility Assigned ID: tomato070140.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5