EST details — SGN-E280068

Search information 
Request: 280068Match: SGN-E280068
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60050Clone name: cLEL-7-B24
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60050 [cLEL-7-B24] Trace: SGN-T18439 EST: SGN-E237075 Direction: 3' Facility: Cereon
Clone: SGN-C60050 [cLEL-7-B24] Trace: SGN-T18620 EST: SGN-E237256 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280068Length: 278 bp (906 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280068 [] (trimmed) CTTCTACTCTGCAACTCACAAAATCAAACCCTTTCTTCTCAAAGGCGTCCTCTCAAATTCCACGCGCCGTCGTACTCTTCCTTCACTGTACGCGC
CACCACTGAAGAATCTTCACCTTCCGACACAGACGAACAAACCACCGTCGATTCATCCTCCGATCCCGACAGTTTCGAGAATCGGCTCTCCCAAG
TCCGTCTCCGGTACCGTAGTGGAACAGGGAAGAAAGCGGAGGTGCGAAAAACTCGAAAGGGCAAAAAAGGTTCATCTGGATCCGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280068] SGN-U577699 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22541 [Download] [View] Facility Assigned ID: tomato070412.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5