EST details — SGN-E280192

Search information 
Request: 280192Match: SGN-E280192
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60057Clone name: cLEL-7-B9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60057 [cLEL-7-B9] Trace: SGN-T18240 EST: SGN-E236876 Direction: 3' Facility: Cereon
Clone: SGN-C60057 [cLEL-7-B9] Trace: SGN-T18712 EST: SGN-E237348 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280192Length: 387 bp (832 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280192 [] (trimmed) TCCATTCTTTCTCCATTTCTTCAATGGCTTTTCCTTGGTCATTTCTCTTCTTCTTCCAAATCATTCTTTGTATTCCCTCTGCCTTCTCCACAAAT
TCTGAAGGGACTGCTTTGCATTCTTTGAGAACCAAACTTTCTGACCCAAAAAATGTTCTACAAAGCTGGGACCCTACACTTGTAAATCCTTGTAC
ATGGTTTCATGTTACCTGTGACTCAGATAATAATGTTATTCGCCTGGATTTGGGCAATTCTAATATTTCTGGAACATTAGGACCAGAACTTGGTG
AACTCAAGAATCTACAGTATCTGTATTTTTCTTTGTTTATCTCTTTTCTTGTATTTATGTTTCTTGTCTCAGATTAGTATCTTTTGTTGGCTGTA
CTGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280192] SGN-U582997 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22475 [Download] [View] Facility Assigned ID: tomato070305.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5