EST details — SGN-E280285

Search information 
Request: 280285Match: SGN-E280285
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72141Clone name: cLER-1-E23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178506 is on microarray TOM1: SGN-S1-1-1.2.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178506 [TUS-29-F8] Trace: SGN-T1497 EST: SGN-E378281 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178506 [TUS-29-F8] Trace: SGN-T184189 EST: SGN-E371422 Direction: 3' Facility: INRA
Clone: SGN-C178506 [TUS-29-F8] Trace: SGN-T184190 EST: SGN-E371423 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280285Length: 374 bp (805 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280285 [] (trimmed) GTGAATATTAATATAAAGCAATAGCTTTATAATAGAATTAAGAAGAAAAGACGAGCAACAAGTTAGTAATTTCCACCATAAATGGTCTTCATTTC
AACTGCTGATCTATGCTCTACAGAGCAGGTGATAACCTGAAAAAACAGTTTGTTGTTGTTTGTGCTCTTTACTGTACATTACAGACAGCAGAGTT
TTCACCAGTCTGTAATATTTGCTCAATGTACCATGCTAGTAGAATCCTTGTGTAAGAAATCTGTATCATTTTTCCTCAGTCGAAGTTGGGCTTGA
TAAGGCTGGTACTGTTGGAAGAGATGGGCGTAGGAGAAGGTATAGTGCTGGACCCAAAAAAGGGATCACCGACAGCGGAAGAAGCCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280285] SGN-U581072 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91839 [Download] [View] Facility Assigned ID: TPRAA36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5