EST details — SGN-E280335

Search information 
Request: 280335Match: SGN-E280335
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72356Clone name: cLER-1-O5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178676 is on microarray TOM1: SGN-S1-1-7.1.4.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72356 [cLER-1-O5] Trace: SGN-T91890 EST: SGN-E280336 Direction: 3' Facility: TIGR
Clone: SGN-C178676 [TUS-29-M10] Trace: SGN-T184012 EST: SGN-E371683 Direction: 3' Facility: INRA
Clone: SGN-C178676 [TUS-29-M10] Trace: SGN-T184013 EST: SGN-E371684 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280335Length: 453 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280335 [] (trimmed) CAACAGCAAGGCCTGGGGACTTAGTTGTGATAGATGTGAAGGGAAGCATACAAGGCAGTGGAGAAGTTTTTGTGGATACATTTGGTGGTGATGGA
ATGAAGAAGAGGCCATTGGCATTAGTAATGGGATCAAGGCCTTATAGTAAAGGAATTTGTGAAGGTATAGAAACAGTACTAAAAAGTATGAAGGC
AGGTGGAAAAAGAAGAGTGATAATTCCTCCAAATTTGGGATTTGGAGAAGAAGGAGCAGATTTAGGAACAGGGCTGCAAATTCCTCCATCTGCTA
CTCTTGAGTATGTTGTTGAAGTTGAAAAAGTTTCTATTGCACCTGCTTGATTGAAGGTATACAAATAAATAGTATAACTTCAAGTGTTTGCTACT
AAAGGAAAATGCAAAACAGTTGATTCTTGTACTGTTCTTTAGTTGACAAGAAAGATGTGTGGAAGTTTGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280335] SGN-U577137 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91889 [Download] [View] Facility Assigned ID: TPRAA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0149 Quality Trim Threshold: 12.5