Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E280410

Search information 
Request: 280410Match: SGN-E280410
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72325Clone name: cLER-1-N19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178654 is on microarray TOM1: SGN-S1-1-5.4.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178654 [TUS-29-L12] Trace: SGN-T184289 EST: SGN-E371522 Direction: 3' Facility: INRA
Clone: SGN-C178654 [TUS-29-L12] Trace: SGN-T184290 EST: SGN-E371523 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280410Length: 427 bp (737 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280410 [] (trimmed) GGAACACTTCCTACTATTTTGGCTATTGAATTTCTAGCCATAGCTTTTGTAGAACACCAAAGGAGTATGGAAAAAGATTCAGAAAAGAAGAAGTA
CCCTGGTGGGGCTTTTGACCCATTGGGCTACTCTAAAGACCCTGCTAAATTTGAAGAACTCAAAGTCAAGGAAATCAAGAATGGTCGTCTTGCAT
TGTTGGCATTTGTGGGATTTTGTGTACAACAATCAGCATATCCAGGAACAGGACCATTGGAGAACTTGGCAACTCACTTGGCTGACCCATGGCAC
AACAACATTGGGGATGTTATTATCCCTAAAGGCATTTTCCCTAATTAAATTGTACTATTTATCATATAGTATATTAGCCAAAAACACCTTGTAAA
ACTCTCCCATGTACTAATAGATTTCTAATGGAATGGACTATCTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280410] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91964 [Download] [View] Facility Assigned ID: TPRAC82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5