EST details — SGN-E280566

Search information 
Request: 280566Match: SGN-E280566
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72304Clone name: cLER-1-M2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178636 is on microarray TOM1: SGN-S1-1-7.3.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178636 [TUS-29-K18] Trace: SGN-T183935 EST: SGN-E371606 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280566Length: 345 bp (1008 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280566 [] (trimmed) GGATGGTCTGTAGCTTGGTCTAAAATTTAGGATTTGTTCAAGGAGGCACTTATAAGGGATGTCGAGTGGGAGCTATACACACTGGTGCCACAGAT
GCAGGCAGCCAATTCGGCCTCGAGGAACTACTTGTCTTTGTCCAAATTGTGGCGGAGGTTTCATTGAAGAGCTCGATGACATGGTAGGTACTAGA
TCTAATATTGAGTCTGATCCTCATTTTGGATTGATGGATCCTTTCCCGGACCCAAGATTTGGTATAATGGATGCCCTTGCTGCATTCATGAGGCA
GAGAATGGCAGGAAGAAACCCAAACTTTGACATTAGGACAAGATCTGGTGTTGTTCCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280566] SGN-U564528 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92120 [Download] [View] Facility Assigned ID: TPRAB73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5