Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E280608

Search information 
Request: 280608Match: SGN-E280608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72252Clone name: cLER-1-J9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280608Length: 486 bp (728 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280608 [] (trimmed) CAAAAATTGGAATACTTAACACACCTTCATGGTACACTGCTGGTGAACAAGAATATTTCACGGACACAACGACTCTCTTCATCGTTGAATTGGTA
CTTATTGGTTGGGCTGAGGGAAGAAGATGGGCAGATATCATCAAGCCTGGATGCGTTAACACGGATCCAATCTTCCCTAACAACAAGCTCACGGG
GACAGATGTTGGTTATCCAGGAGGTTTATGGTTTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAGATAAAGGAGTTGAGGACAAAGGAGA
TTAAGAACGGTAGACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGATAACCTATTTGCTCAC
CTAGCTGATCCTGGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTGTAATGATGTGTAAAAGT
AACATTTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280608] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92162 [Download] [View] Facility Assigned ID: TPRAC53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0098 Quality Trim Threshold: 12.5