EST details — SGN-E280644

Search information 
Request: 280644Match: SGN-E280644
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72239Clone name: cLER-1-J16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178584 is on microarray TOM1: SGN-S1-1-3.1.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178584 [TUS-29-I14] Trace: SGN-T183997 EST: SGN-E371668 Direction: 3' Facility: INRA
Clone: SGN-C178584 [TUS-29-I14] Trace: SGN-T183998 EST: SGN-E371669 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280644Length: 439 bp (789 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280644 [] (trimmed) CAGACCAGCTCCAGATTCTCCTCCTCCATCAGAGTCAAAATCACCTCCACCTAACCCCTTAACATCTCCACCCCCTTCTATCTCACCTCCTGCTC
CCCCAAATAATACTTCTCCAGCTGGAGCTCCCCCTCCATTGCCTGTGACTCGCCTTCCTACAGAGAAGCCCACTGCTATCCCTAAACCTGCTATC
ACTGCAGATTCAAGTGCCAGAAATGGTGGGGGAAATAAGGCAGGAAGTGTGGTGGCAATTGGTGTTGTTGCTGGGGTTTTGGCCCTTAGCTTGGT
GATTGTTGCTGTCTGGTTTACACGTAGGCGAAAGAAAAGAGAGAGTGCATTTAATCTCAATTACCTGGGACCCTCTCCATTTGCTTCCTCACCAA
ATTCAGATACATCATTCCTGAGATCAAGGTCTCAAAATTCCACTTATCTAGCTCCAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280644] SGN-U583629 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92198 [Download] [View] Facility Assigned ID: TPRAD56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0151 Quality Trim Threshold: 14.5