EST details — SGN-E280838

Search information 
Request: 280838Match: SGN-E280838
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59799Clone name: cLEL-6-H20
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59799 [cLEL-6-H20] Trace: SGN-T17408 EST: SGN-E234630 Direction: 3' Facility: Cereon
Clone: SGN-C59799 [cLEL-6-H20] Trace: SGN-T17888 EST: SGN-E235110 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280838Length: 268 bp (1173 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280838 [] (trimmed) AATATCTCATACCATCTTACACTTACATTTCTCTTGATATAAGGACCATGGCAGCTGCTACAATGGACATTTCTTCCCCTTCTTTTGCTGGACAA
GCAGTGAAACTCTCACCATCTGCCTCAGAAATCACAGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCAAAGTCAGCTCCATCTAGCAGCCC
ATGGTATGGCCCTGACCGTGTTAAGTACTTGGGTCCATTCTCTGGTGAGTCCCCTAGCTACTTGACCGGAGAATTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280838] SGN-U579405 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22285 [Download] [View] Facility Assigned ID: tomato060446.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0195 Quality Trim Threshold: 14.5