EST details — SGN-E280907

Search information 
Request: 280907Match: SGN-E280907
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59883Clone name: cLEL-6-L1
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59883 [cLEL-6-L1] Trace: SGN-T17620 EST: SGN-E234842 Direction: 3' Facility: Cereon
Clone: SGN-C59883 [cLEL-6-L1] Trace: SGN-T17716 EST: SGN-E234938 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280907Length: 349 bp (1262 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280907 [] (trimmed) AACGACCAGAGACTTGAGAACGTTTTAAGAGATTCATTTTCCCCCGACAAAGTTTGTGGCGAAAGCCCAGGCATTGTTGTTTACGGGGTCTGCAA
GGTGGTCAGCAAGGTTCTCCAATGGACCCTTTCCGGTGACAATAGCTTGAACAAAGAATCCAAACATAGAGAACATAGCAAGTCTACCGTTCTTG
ATCTCCTTTACCTTGAGCTCAGCAAATGCCTCTGGGTCTTCAGCAAGGCCTAATGGGTCGAAGCTGCCACCAGGGTAGAGCTCGTGCCGCTCTGT
CATTTCTTCAGTAGCTGTTGTCACACGCAGTAATGTTACACAAGCTAGCATGGTTGCACCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280907] SGN-U581176 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22222 [Download] [View] Facility Assigned ID: tomato060361.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0075 Quality Trim Threshold: 20.5