EST details — SGN-E280959
| Search information |
| Request: 280959 | Match: SGN-E280959 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C74079 | Clone name: cLER-7-K5 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E280959 | Length: 194 bp (889 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E280959 [] (trimmed)
GCAGCTAAACGTATCCGCAATTGAAATCTATTACAATGTTGTACTCAAGGCCTGCATTATGACATTTTGTGTGCTTTAAAGGATGCATATTTCTT
AGTTTGATGTGTGGTATGCTTTGTATTCTTATTTCTTAAGACAATTCTGAGAATGTTGAGTTGTACTGTACTATCTTCTGAATAAAAGCAGTTCT
TATT
AGTTTGATGTGTGGTATGCTTTGTATTCTTATTTCTTAAGACAATTCTGAGAATGTTGAGTTGTACTGTACTATCTTCTGAATAAAAGCAGTTCT
TATT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E280959] | SGN-U571519 | Tomato 200607 | Build 2 | 5 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T93422 [Download] [View] | Facility Assigned ID: TPRAY63TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.869 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |
Working
