EST details — SGN-E281043

Search information 
Request: 281043Match: SGN-E281043
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74055Clone name: cLER-7-J2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185965 is on microarray TOM1: SGN-S1-1-6.1.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185965 [TUS-48-M3] Trace: SGN-T1915 EST: SGN-E378239 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185965 [TUS-48-M3] Trace: SGN-T188197 EST: SGN-E376157 Direction: 3' Facility: INRA
Clone: SGN-C185965 [TUS-48-M3] Trace: SGN-T188198 EST: SGN-E376158 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281043Length: 462 bp (773 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281043 [] (trimmed) CAATCCTCAGCAAAAGCTTCTTCCATGGCTTCAATTTCAGCAGCTTCTGCAACTGCTGCTGCTGCTGCTTCTACAAAGATTAATACCAGTGGTAC
TGTTCTTCCTTCAAAATCCTCTAAGCTTATCCTTTCATCTTCTTTTACACCAAACCCATCAACCCTTTTCCTCCATTCACCCGCCACTACTGCAC
CTTCTTCTTCTTCCTCCCGCCACCGCCGGTTTACTGTCCGAGCTGCGCGTGGTAAATTCGAAAGGAAGAAACCCCATGTCAATATTGGTACAATT
GGCCATGTTGACCATGGGAAAACCACACTTACAGCTGCTTTGACAATGGCGCTTGCTTCTCTGGGTAACTCCGCCCCGAAGAAGTATGATGAAAT
TGATGCTGCCCCTGAAGAAAGGGCTCGTGGTATTACGATTAATACTGCCACAGTGGAGTATGAAACTGAAAATCGGCATTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281043] SGN-U577523 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93506 [Download] [View] Facility Assigned ID: TPRBB49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5