EST details — SGN-E281147

Search information 
Request: 281147Match: SGN-E281147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74082Clone name: cLER-7-L1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185335 is on microarray TOM1: SGN-S1-1-4.2.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185335 [TUS-47-B21] Trace: SGN-T192231 EST: SGN-E390905 Direction: 3' Facility: INRA
Clone: SGN-C185335 [TUS-47-B21] Trace: SGN-T192232 EST: SGN-E390906 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281147Length: 472 bp (763 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281147 [] (trimmed) GAACTTGTAAACTGAGAAATTTTAGTGATTTCAAGAATCCTAAGAAAATCACAATGGCAGCAACAGCAACAACTTCATATTTAAGTGCTCTAGAC
AAAAAGACTCCATTTTTATTTGCCTTGGACAAAAAGACTCCATTTTTATGCCCAAAAAACAGCACAAAGAGAAGGTCATTTAATGGAGGAGTTAA
GTGCATGGCAATAGAGACAGCTTCAGGTGTTACACAAACCAAGAAAAAGAGTGGCTATGAGTTACAAACTTTAACAAGTTGGCTATTGAGACAAG
AACAAGCTGGAGTTATTGATGCTGAACTTACCATAGTAATTTCAAGTATTTCAATGGCTTGTAAACAGATTGCTTCTTTGGTCCAAAGAGCTGGA
ATTTCTAACCTTACTGGAGTTCAAGGTGCTGTCAATATTCAAGGAGAAGATCAGAAGAAACTTGATGTTGTCTCTAATGAGGTTTTCTCGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281147] SGN-U583766 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93610 [Download] [View] Facility Assigned ID: TPRBA61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5