EST details — SGN-E281205

Search information 
Request: 281205Match: SGN-E281205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53694Clone name: cLEL-1-C9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53694 [cLEL-1-C9] Trace: SGN-T2513 EST: SGN-E216997 Direction: 3' Facility: Cereon
Clone: SGN-C53694 [cLEL-1-C9] Trace: SGN-T20559 EST: SGN-E281407 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281205Length: 295 bp (1565 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E281205 [] (trimmed) TCATACTGTTCTTGAAAAGAAGTTGAAATTGAAAAGGATGTTTGGAAGAGGAGGGAGGGGAAAGAGTGATAACACAAAGTTTTACGAAATCTTGG
GTGTTTCCAAGAATGCTTCAGAAGATGAAATCAAGAAAGCTTATAGAAAAGCTGCTATGAAGAATCACCCTGATAAGGGTGGTGATCCTGAAAAG
TTTAAGGAGCTAGCTCAAGCTTATGAGGTCTTGAGTGACTCACAGAAGCGTGAGATTTATGATCAGTATGGAGAAGAAGCACTGAAAGAAGGAAT
GGGTGGTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281205] SGN-U578772 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20558 [Download] [View] Facility Assigned ID: tomato010117.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5