EST details — SGN-E281404

Search information 
Request: 281404Match: SGN-E281404
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53688Clone name: cLEL-1-C3
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T2128 EST: SGN-E216612 Direction: 3' Facility: Cereon
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T2420 EST: SGN-E216904 Direction: 3' Facility: Cereon
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T20553 EST: SGN-E281203 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281404Length: 303 bp (597 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281404 [] (trimmed) AGCAACTTTAGAATCAATAAGAAAATAAATGTACATCCTCAAGGGTGATATAGACGTCTCTTTTTGGGCATGTTGCCATTAAGAGATTCATCAAA
GGAGAAACTAAATTCTGAAAATTTATCAAATTCACTTGTCATGTCTAAAAACTGCTTTTGAAGTTCCTCCAATGTGTTTTCTCCCTTAGATTTCT
CAGTTCCAACATTGTTATCATTTCTTGCATAAACTCACAAAATTCTTTATCATCATCAGAATCATCTCCCATTGAGTTGAAGCAACTTTAGTGTC
ATAATAGTGGATTTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281404] SGN-U566084 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20554 [Download] [View] Facility Assigned ID: tomato010114.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0250 Quality Trim Threshold: 14.5