EST details — SGN-E281407

Search information 
Request: 281407Match: SGN-E281407
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53694Clone name: cLEL-1-C9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53694 [cLEL-1-C9] Trace: SGN-T2513 EST: SGN-E216997 Direction: 3' Facility: Cereon
Clone: SGN-C53694 [cLEL-1-C9] Trace: SGN-T20558 EST: SGN-E281205 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281407Length: 246 bp (586 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281407 [] (trimmed) CCCCAAGAAAATAATATTTCTATTTCACTAAAGCATCAGTTTTTTGACTTCCCAAAACATGTCATTTCCAAAACAACAGAAAACAGTAAACCAAA
CTAAACTATAAGCAAAGTTCAAACTGGTAAATCTTTCTACATCTACTGTTGAGCACACTGTACTCTCTGTCCTCCACCACCAGACATCTCTTCAT
CCTCATCATATGCTTCTTGTTGGGCAGCTTGGTTCCTTCTCATTTCTTCCTCCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281407] SGN-U581384 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20559 [Download] [View] Facility Assigned ID: tomato010117.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.887 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5