EST details — SGN-E281531

Search information 
Request: 281531Match: SGN-E281531
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53852Clone name: cLEL-1-J21
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53852 [cLEL-1-J21] Trace: SGN-T2274 EST: SGN-E216758 Direction: 3' Facility: Cereon
Clone: SGN-C53852 [cLEL-1-J21] Trace: SGN-T2357 EST: SGN-E216841 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281531Length: 287 bp (608 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E281531 [] (trimmed) AGGCCACTACCTCCACCTCCTGGGCTTGCGCTGAATATTCCTAGGCCTCCTAATCGATTCCAGTATTCCACACCTACCATAGCTGGTGCTGCTCC
GCCTCCACCTCAACCTCCTATGGTTAACATGATTCCTCAGGTTCGGCCCCCACCTCCTCCCATGCTACAACTACAAGGTCAGCAAAACCTCATGG
TCAATCGTCCCCCAATGCCTCCATCAATGGCTATGAGTTCGCATACCCTTACTATTCCACCACCTCCTGGATCACAGTTTACACCTATGGGAGCA
CC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281531] SGN-U583168 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20791 [Download] [View] Facility Assigned ID: tomato010359.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5