EST details — SGN-E281922

Search information 
Request: 281922Match: SGN-E281922
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77534Clone name: cLES-2-F2
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190128 [TUS-59-J14] Trace: SGN-T340575 EST: SGN-E539700 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190128 [TUS-59-J14] Trace: SGN-T349139 EST: SGN-E548264 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281922Length: 436 bp (800 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281922 [] (trimmed) CTTGAAGCCCATTTGCTTTCAATTGGAAGGATAATTGCTCCCATCTTACCCCATTTGGCCGAGGATATGTGGCAGCATCTTCCTTTTCAGTATAC
TGCTGAAGATGGGCATGTTGCTAAATTTGTTTTTGAGTCAAGATGGCCTGAACTAGATACAGAGTACCTTTCCTTTCCAGAGGAAGAAGTTGACT
TTTGGGGAAAAATTCTTGAGCTAAGGACGGAAGTTAACAAAGCATTAGAGGTAGCTCGAAGTGGAAAATTGATTGGTTCCAGTTTAGAGGCCAAG
GTGTATCTCCATTGTTCTAATGAAAGACTGGCTGAGAGACTAAACAACATGTGCGAACCTACAAATGAGGCAGATGCTTTACATCGCATATTCAT
AACATCTCAGGTGGAGATTCTCAACTCCTTGCAAGATGAAAGGATTAAAGATGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281922] SGN-U584263 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97082 [Download] [View] Facility Assigned ID: TPSAH25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5