EST details — SGN-E282368

Search information 
Request: 282368Match: SGN-E282368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71615Clone name: cLER-18-I12
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185403 is on microarray TOM1: SGN-S1-1-8.1.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282368Length: 499 bp (678 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282368 [] (trimmed) GGAAAGTAGAAAAGATTCCCTAAAACACTCACCACCTGTTGTCATTCCCAAAATCCAACCTTTTTACTCCTACTTTCCTCTATATTTCTTCCTTC
TTCTTCTCCAAAAAAAATTCTCCATAAAATTCTAAGCAAAACCCATAAATTTTCTTTGATTTTTGAGTATTAATAACCATGGAAGCTGTGTTCAA
AACCCAGAGTTTGTTCTTGAAGTATGGGGTTTGTTGGCAGTTGTTCTTGCTGTAGCTGTGGCTGTAAAGGGGAATTCAGAAGGGGATGCTTTGTA
CGCCCTCCGCCGGAGCTTATCTGACCCGGGTAACGTGTTACAGAGCTGGGATCCAAATCTTGTTAACCCTTGTACCTGGTTTCATGTCACTTGCA
ACGGAGATAATCAAGTTACTCGTGTGGATCTTGGGAACTCAAAGTTATCTGGTCATTTGGTACCTGAGCTCGGAAAGCTTGAACATCTACAGTAT
CTGGAGCTTTACAAAAATAATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282368] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96164 [Download] [View] Facility Assigned ID: TPRCR54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5