EST details — SGN-E282409

Search information 
Request: 282409Match: SGN-E282409
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71684Clone name: cLER-18-L19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184172 is on microarray TOM1: SGN-S1-1-7.2.16.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184172 [TUS-44-B10] Trace: SGN-T198352 EST: SGN-E397026 Direction: 5' Facility: INRA
Clone: SGN-C184172 [TUS-44-B10] Trace: SGN-T199988 EST: SGN-E398662 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282409Length: 390 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282409 [] (trimmed) CAGAATCGATCAGATTTCTCCGTTGCTCAATTTCCCGGCGACTTCTCCACCGGAATTTCTCCATTTCCGGTTTTTGATGAGCTATAGTTGAAGGT
TGCTTTGCTTTTGGTGATCTGTGGGAAATGAGTGTTCAGTGATGAAGAAAGTGAAGAGAAAGCTTGGGAAGTATGAAGTTGGCAGAACTATTGGT
GAAGGGACATTTGCCAAGGTTAAGTTTGCACGAAACACCGAGACTGGAGAGAATGTTGCCATTAAAGTCTTGGCCAAAAGTACCATTCTTAAGCA
TAGAATGGTTGAACAGATCAAAAGAGAGATATCTATAATGAAGATTGTCAGACATCCTTGCATAGTTCGACTTCATGAGGTTTTAGCTAGCCAGA
CAAAAATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282409] SGN-U583290 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96205 [Download] [View] Facility Assigned ID: TPRCS70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5