EST details — SGN-E282439

Search information 
Request: 282439Match: SGN-E282439
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71751Clone name: cLER-18-P20
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282439Length: 257 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282439 [] (trimmed) ATTGTTTTTANCTATGGCTTCATCTAAAGTGGACTTAACAAAAAAGAAAGACCCCAAAGCCCAGGCTGTCAAGGCTGCCAAGGCTGTTAAGTCTG
GATCAACCTTTAAGAAGAAGTCAAGTAAGATAAGGACAAAAGTTACTTTTCATCGACCTAAGACATTGAAGAAGGATAGGAATCCCAAGTACCCT
CGCATTAATGCACCTGGAAGGAACAGACTTGATCAGTACCAGGTTCTAAAATGTCCTCTTACGACCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282439] SGN-U577327 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96235 [Download] [View] Facility Assigned ID: TPRCT94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0238 Quality Trim Threshold: 12.5