Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E282615

Search information 
Request: 282615Match: SGN-E282615
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70697Clone name: cLER-15-K1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178789 is on microarray TOM1: SGN-S1-1-6.2.3.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178789 [TUS-30-B3] Trace: SGN-T184643 EST: SGN-E372203 Direction: 3' Facility: INRA
Clone: SGN-C178789 [TUS-30-B3] Trace: SGN-T184644 EST: SGN-E372204 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282615Length: 544 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282615 [] (trimmed) CAAAATAGCGATTTTCGTCACACGCAAACGAAGAAGGAGCAGAATTCACAACACCTCTTATTCCCAAATCTTGGATTATAACTTTGAAATCTGAA
TCTTGATTTGAAACTCAAGAAATTAGTGAAAATATGATGACAGCTACCATGACAACAACGGTCTCTGTTGGGTCATCTTCATTTTTCACTAATTA
TCCTCTTATGTCTGCTCTTATTGCCTTTGCTCTTGCCCAATCCATCAAGCTCTTCACTTCATGGTACAAGGAAAGACGATGGGATCTTAAGCAAC
TTGTTGGATCTGGTGGAATGCCCTCATCCCATTCATCAACAGTAACTGCTCTAGCTGTGGCTGTTGGTTTGCAAGAGGGCTTTGGGGGGGCGCTT
TTTGCTTGTGCATTAGTTTTAGCGTGTGTGGTCATGTATGATGCCACGGGTGTAAGATTACATGCTGGACGTCAGGCAGAGGTCCTGAATCAAAT
TTTATACGAACTTCCTTCTGAACATCCTCTTGCAGATAGTAGGCCATTACGAGAACTCCTTGGTCACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282615] SGN-U564566 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95135 [Download] [View] Facility Assigned ID: TPRCE61THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5