EST details — SGN-E282623

Search information 
Request: 282623Match: SGN-E282623
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70758Clone name: cLER-15-M7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178808 is on microarray TOM1: SGN-S1-1-3.2.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178808 [TUS-30-B22] Trace: SGN-T184914 EST: SGN-E372122 Direction: 3' Facility: INRA
Clone: SGN-C178808 [TUS-30-B22] Trace: SGN-T184915 EST: SGN-E372123 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282623Length: 466 bp (785 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282623 [] (trimmed) GAAAGTTGTAAAGGGAGCATCAGCTAATACTGGATACGGAAAACGTGTGGAACATCTGAAATCAATCTTCAAAGCTTGTGGGATGAGTGTTGCTC
CTTTTCTTTATAAGAGAGCCAAACAGGTATCTGACGACAAACGTGAAGGCTTCCTGATAAAGGAGTTAGAAAAGATGCTTTCTGCAGAAGGACTA
TCATCGAACCCCACCGAAAAAGAAATCAAAGAAGTCAAAAAGAGAAAGCAAACAGCAAAAGAATTGGAAGGTATTGACTTAAGCAACATTGTTTC
AAATACACGAAGGAGATCAACGACCAGCTTTGTGGATCCTCCAAGACCCAAGTCACCACCTAAAAATGATAAGAATGATGACAAGGATGGTGATA
GCGATGCCGATGATGGAAGTGATGATGACAAAGACGATGATGACGATGAAGATGATGAGAGCAGTCAGAGTGATGAGGAGTTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282623] SGN-U566857 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95143 [Download] [View] Facility Assigned ID: TPRCE76THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5