EST details — SGN-E282627

Search information 
Request: 282627Match: SGN-E282627
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70783Clone name: cLER-15-O1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178820 is on microarray TOM1: SGN-S1-1-7.3.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178820 [TUS-30-C10] Trace: SGN-T184571 EST: SGN-E371957 Direction: 3' Facility: INRA
Clone: SGN-C178820 [TUS-30-C10] Trace: SGN-T184572 EST: SGN-E371958 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282627Length: 519 bp (788 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282627 [] (trimmed) AAACGATAAAAATACTGATTTTAAGGTGCCAAATAAATACATTTTACAACTAGAAGGTAAGATATTCAAAATAATATCCATCAATTGTAGAATAC
TAAAGATATTTGCCTTTCTAATATTCACTCTTTCTAATGTTTCACAATCTTTTATACCAACTAAACGAAATTATATAAATTGCCAAAAATTGAAT
TACATTTAAAGCTACCAACGAATATAAATGGCATACAAATTAAAATAAATAAATAGATAAATAAATACTGATTAATCCACCACTCGATGGTGGTT
TAGCTCTAATTAACTAATAAAATTTCCTAAGACGACACTCTATAGTATCTATTTTTCAGCTTTTACATATTAAATTTTTGTACAATTTAGCTGAA
CCAATCAAATAAAAATGAGGTCGCTCTATTTCATAGACAAGACTCCTAATTAGAGTTTGAGTCTTCCAAAAAGGTGGACGAAAGTTGATCATTTT
CACATAATAAAACAACCATTAGGATTTTCATCACTAAACATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282627] SGN-U579681 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95147 [Download] [View] Facility Assigned ID: TPRCE85THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0053 Quality Trim Threshold: 12.5