EST details — SGN-E282764

Search information 
Request: 282764Match: SGN-E282764
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70522Clone name: cLER-15-C11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178717 is on microarray TOM1: SGN-S1-1-6.3.4.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178717 [TUS-29-O3] Trace: SGN-T183806 EST: SGN-E370465 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282764Length: 414 bp (777 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282764 [] (trimmed) GGTTAAACAAGATATTATATTAATAATTAATATGCGTCATTACATTTTTTGGAAGGGGCAATATTACTATCACAATTATACAAAGCAATTCCCCT
TAAAAGTTACTTATAAGTTCCTTTACAAGCAAGGAAAATTCTTTAGTTTTCAAAGGATCAATAATCTCCGAGCCATGATAAAATCCTTGAGTGAA
ACTACCCTCTACTTGAACGTCCAATTCTTTCAACACCTTTACTAAGTCAACTTGGCGGTCAATCAAAGGATCACCATCACAGCCAGTCACCAACA
TCTTCCATCCTAATAATTTTACTTGATCCAATAAATTCGGTTTTGATTCAATCCCCACCATTGGATTTGAATACTCATGATCGCGATCAGCACCT
TCAGGCAATCCTAGGTCCCACATGATATCACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282764] SGN-U566694 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95284 [Download] [View] Facility Assigned ID: TPRCE18THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5