EST details — SGN-E282800

Search information 
Request: 282800Match: SGN-E282800
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70493Clone name: cLER-15-A22
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178707 is on microarray TOM1: SGN-S1-1-8.2.3.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178707 [TUS-29-N17] Trace: SGN-T184088 EST: SGN-E371019 Direction: 3' Facility: INRA
Clone: SGN-C178707 [TUS-29-N17] Trace: SGN-T184089 EST: SGN-E371020 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282800Length: 264 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282800 [] (trimmed) ATTGGAAATTTTAAACAACTCCAAGATTTAGCAATCAGGTTTGGCATGGTAGGATCTTGATTATGGATGATATGATATTTCAAGGCGGCTCTCAG
ACAATCGCCCTGCACTGTCTTACATGTGAAAATGTATTTTGATTTCTTACACCCAGAGTCCATTGAAGACATGGGGTATTCTCTAAGTAAGTTAG
AAGTAGACACCGGACTCTTTGATGGTTCAAGTTCCAATCATGGGGTTGCTAGCAGTGTTCATCATGAGAGACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282800] SGN-U572324 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95320 [Download] [View] Facility Assigned ID: TPRCF11THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5