EST details — SGN-E283097

Search information 
Request: 283097Match: SGN-E283097
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71239Clone name: cLER-17-E5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178861 is on microarray TOM1: SGN-S1-1-6.1.3.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178861 [TUS-30-E3] Trace: SGN-T184339 EST: SGN-E371725 Direction: 3' Facility: INRA
Clone: SGN-C178861 [TUS-30-E3] Trace: SGN-T184340 EST: SGN-E371726 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283097Length: 381 bp (618 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283097 [] (trimmed) ACCCAAAGAGATATCTGATTGAAAATATATTTTTTCAATTGATTGAGAGATTCATAATGTGTATTTGTATTTTTGGGATTCAATAATCAACAAAA
ACTGTTTTTGGGTGTAATCAAATATCTTATGTTTGATAAACCGCCAAGAAAATATTGTCTCGCGAACATTTAAGCTGATGTAGAGGTAGTGTAAG
AGCAATCTCTTGTTGTAATGGTATTTGATGAATGTGTGAGTGGTTGGCTTTCGTTTGTATCTTCATACTTGTCTCTTAACCCTTGAAAGCCGAAA
CGATCATAATCATCATAGAATCTTGATTCCATTGTAAACTCAGGGAGGTCAAGATGATTTTCAAGAATTTTGACTACAGCAGACATGGTTGGCCT
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283097] SGN-U574242 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95948 [Download] [View] Facility Assigned ID: TPRCM27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5