EST details — SGN-E283100

Search information 
Request: 283100Match: SGN-E283100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71233Clone name: cLER-17-E21
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186347 is on microarray TOM1: SGN-S1-1-8.1.5.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283100Length: 432 bp (625 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E283100 [] (trimmed) TCGATTCTTAGAGAACATATACCTGAACCATCTCATACAACATTGGCATTAGCATGTGGACCACCTCCAATGATACAATTTGCTATTAATCCAAA
CTTGGAGAAAATGGGATATGACATTAAGGAGGAACTATTGGTGTTCTAAATTGGATGGTGATGATGATAGATGATATATCTCTTTGGAGGAATAA
ATTCTTTTGTATTTTCAGTTGTACATATTGTGTTTTTGTTTATCATCAAAATGTACTACTTCTTGTAGTTCTTACATTTTAATTTTCTACTCAAC
TTTAGGTATAAAATGTTGTACTGTGTACTAGTATGTGTATGTCAAAGTTAAGATTGTATTCATCATGGAATTACAGTAACTTTGTTGTCACAAGT
CTTGTTGTAGAGATTTTTACCAAATTAATGTGTATATATATATAGTAAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283100] SGN-U579543 Tomato 200607 Build 2 103 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95951 [Download] [View] Facility Assigned ID: TPRCM35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5