EST details — SGN-E283131

Search information 
Request: 283131Match: SGN-E283131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71455Clone name: cLER-17-O5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178925 is on microarray TOM1: SGN-S1-1-6.3.2.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178925 [TUS-30-G19] Trace: SGN-T184354 EST: SGN-E371740 Direction: 3' Facility: INRA
Clone: SGN-C178925 [TUS-30-G19] Trace: SGN-T184355 EST: SGN-E371741 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283131Length: 428 bp (620 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283131 [] (trimmed) TTTTAGCAGAGTAATCCGCCGGACTTTTTCCACGGCTGAAGCCTCAGTATCTCCGATCAGAGTAATCTCCGACGACTTATACAAAGAGAGGAACC
TCAAAAGACTCGTTGAGAAATTCAAACAGTATTCAGATGTCACAAGATTCCGCACAAAAACCGGCATTTACGAATCTACAGTTCATCGATTAGCC
TCTGCAAAACGGTACAAATGGATCGAAGAAATCCTCGAACACCAAAAACAATACCGACCCGACATCTCCAAAGAGAGTTTCGCAGCAAGGCTGGT
GAGTTTGTATGGAAAGTCTGGGTTATTTGAGAATGCCCAGAAACTGTTTGATGAAATGCCTGAAAGAAATTGTAAGCAGAGTGTGAAATCTGTTA
ATGCCCTTTTAGGGGCTTGTGTGAATTCGCAGAAATATGAAAAACTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283131] SGN-U582865 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95982 [Download] [View] Facility Assigned ID: TPRCM87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5