EST details — SGN-E283227

Search information 
Request: 283227Match: SGN-E283227
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71357Clone name: cLER-17-J6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178898 is on microarray TOM1: SGN-S1-1-1.2.3.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178898 [TUS-30-F16] Trace: SGN-T184933 EST: SGN-E372141 Direction: 3' Facility: INRA
Clone: SGN-C178898 [TUS-30-F16] Trace: SGN-T184934 EST: SGN-E372142 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283227Length: 375 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283227 [] (trimmed) AAAGCTATGATTGCAACTTATCCAACCATCCAGGGTAAAGGAAGAGTTGAAACAAATGTCCATTTCTAAGGACATAGAAAAAGGGCATAGAAATG
AGCTACAAGTTACATTCAAATACATAACCAATAGAAGGTTATTGTCGTTGCTCGAAGCCATGACTGGACAATAATGAGGGAAGACCATTACGACT
CTCAGGCTTCCAAACCTCTTTGATTTCTATGTTGATATATATCGTATGCTGGTTCTTCATCTTCTGCGTTGATCCCGGTAGGGTCCTTCATCTTC
CTGGTCTTTCAAGAGGCCTAGGAAAGCAAGAAACCCGAAAAAGAAGAACCCACCTTTTCAATTGGCTTCGGCACCCCCACCTTCACCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283227] SGN-U580967 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96078 [Download] [View] Facility Assigned ID: TPRCP51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5