EST details — SGN-E283258

Search information 
Request: 283258Match: SGN-E283258
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69688Clone name: cLER-12-E5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189846 [TUS-58-N20] Trace: SGN-T340091 EST: SGN-E539216 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189846 [TUS-58-N20] Trace: SGN-T340093 EST: SGN-E539218 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283258Length: 492 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283258 [] (trimmed) CAGGTTACCTCAGAGGACCAGGTGGTCGATTCCGTAATCCATATGATCATGGGTGTAAGAAGAACTGTTCAGATTTCTTGATAAACGGTTACAAC
GAAGACATTGAGTGTGTTGAAGAATCGGTTGAGTCCGAAGGGATTGGAATGATGCAGATTCCTCACAGTTCAAGTATGCAAAACGGCACCGGCCA
TTCTCATCAGATCAATGGAAATGGCCATCATGTTATCAATATAAGCAACAATAACCAGAACTCACACCAGGCCCATGTTCATTCTGCCCATTGTA
GTCATAATGTGAAGAGCAAAACTGATTCTGTACCTGTGGGTTTGGGTGTTGGCTTAGGAAGAAACGCCGCGCGTGCCGCGCTACCTTCATAACCT
AGTGTGCCGTTGGCTTTTTTTGGGTATTTAGAATCCCTTCTTTTTGACCTTTTATTTGTTTATATATGCTTCACACACACTCGTTTTAGAGCTTA
AGTTATTCATTTGGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283258] SGN-U583683 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94225 [Download] [View] Facility Assigned ID: TPRBS27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0162 Quality Trim Threshold: 12.5