EST details — SGN-E283304

Search information 
Request: 283304Match: SGN-E283304
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69781Clone name: cLER-12-J15
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185993 is on microarray TOM1: SGN-S1-1-2.2.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185993 [TUS-48-N7] Trace: SGN-T192567 EST: SGN-E391241 Direction: 5' Facility: INRA
Clone: SGN-C185993 [TUS-48-N7] Trace: SGN-T192809 EST: SGN-E391483 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283304Length: 625 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283304 [] (trimmed) CATTAACGAACCAAATCACCAAAACCTAAAGGAGAAAAATGGCAGCTTCGAGCATTGGGCATCAGATTCATATTAATGTCAATTCTCCAATTCTT
CTTCCTTTGAGAACCAATTTCAGTTCACTCTCTTTCACTTTCTCTAATGCTAGATACCCATTAAAATGGAATCACATTGGTTGCCCCAAAATTTG
TGCTCTACCAGCTGTTTCAATAATTGCTTCTGGAAGTTCTAGAGAGATGCTTCCTCCTGCCCTTGATTCCTCTTCAGAGCCACCAGCAATCTTTG
ATGGAACTCCAAAGCTTTATATCTCTTACTCATGCCCATATGCCCAACGTACGTGGATTGCTAGAAATTGTAAGGCGCTGCAGGAAGAGATTAAG
TTGGTTCCTATTGATCTAAAGAACAGGCCAGATTGGTATAAGGAGAAGGTTTATCCAGCAAATAAGGTACCATCACTGGAACACAACAATGAAGT
TAAGGGAGAGAGTATGGATCTCATTAGATATATTGACAGTAACTTTGAAGGGCCATCACTTTTCCCTGATGATCCTTCCAAGAGAGAATTCGCAG
AAGAATTATTCTCCTACTTTGACTCCTTTTACAAAGCTGTAATTTCGTCTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283304] SGN-U570711 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94271 [Download] [View] Facility Assigned ID: TPRBU56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5