EST details — SGN-E283315

Search information 
Request: 283315Match: SGN-E283315
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69661Clone name: cLER-12-D2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185989 is on microarray TOM1: SGN-S1-1-6.2.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185989 [TUS-48-N3] Trace: SGN-T192565 EST: SGN-E391239 Direction: 3' Facility: INRA
Clone: SGN-C185989 [TUS-48-N3] Trace: SGN-T192566 EST: SGN-E391240 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283315Length: 592 bp (938 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283315 [] (trimmed) TTTTTTTTGTTACAAAGCATATATTTATTTCTATAGTAAGAAAAATAATCCCACAATCGGAGACACACTCAATCTTGCCCTAAAATATTGATGCT
TCTTTTGGATGTAGAGACATCTTAAATGCATGTATACACATTTCCTTCTTTCTTTCTTCCGTCTCTTCGGAGTCTCAGCTTATAACTCAACAACA
TACACAAACGTCTGAAAAAACTCAGACGCATGACTAAATATCAGCTATTCTCCATCGGTGTTCCATGCTGGTACGTACAAAAAGAATGTTGTCCA
AGCCTTAACATCTTCGTCGAGTAAAAATACCTATTTTCAAGTTTGTGGATCCAAAATCTGGAAGATGACTGACTAAGCAGCAGCTGCTTCCTCCT
TTTTGGCAAGCTGGTTTTGAATGTGTTGAGGGACAACGTCAAATTTGGCTAACTGCATAACATACGATGCACGCCCCTTTGTCATTCCTCGCAAG
GTACTAACGTAATTGAACATCTCTGCTAATGGAACTAAAGAATCCACCACCTTGAGACCTCCAGGCTTGTCTCCAAAGCTGTTGATCTGGCCTCT
CCTTGAGTTAAAGTCACCAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283315] SGN-U579489 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94282 [Download] [View] Facility Assigned ID: TPRBV13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5