EST details — SGN-E283510

Search information 
Request: 283510Match: SGN-E283510
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69854Clone name: cLER-12-M7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189866 [TUS-58-O16] Trace: SGN-T340125 EST: SGN-E539250 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189866 [TUS-58-O16] Trace: SGN-T349065 EST: SGN-E548190 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283510Length: 505 bp (824 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283510 [] (trimmed) TCTGTCCAATGAGGAAGATATCCGGGAACACTTCTGTGTAGCCAAAACTAAATTGACAAGTAAATCACACAAGTTTCAGGCTTGAGACAGGTCAC
GACTACCTCGAGTATTTTCTCAAACAAAAACTACATCCACAACCTTCACAAGCTTCGGAATACAACAAATACTTCCCAAAGTTACAACATAAAAT
TGTGCAAGGCATTGTAAAATACTATAGCTCCTATATAAAAATGACATACAAGAACTCCCAGTCTCAAGTCTCTATAGCTTGTCTAAGTGATTTAT
GCTGCAACAGTCTTTGGCTTCGCGCCAATTTTTTTCCAGGAAACACTAGGCATTATCTGCTTTGTGTCGACACGATCCTTATATTGAACAGCAAA
GTTCAATAGAGAGTCGAGAAGAGAATCAGAAAGAAGGTGAGGTTGTAGTCCCAGCTCAATAAGTTTAGTATGTTTGGCATTGTAGTAGTGTTCCT
CTGCTTCTACTCTTGGATTGGGCACTGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283510] SGN-U580292 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94477 [Download] [View] Facility Assigned ID: TPRBS76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0215 Quality Trim Threshold: 14.5