EST details — SGN-E283599

Search information 
Request: 283599Match: SGN-E283599
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77012Clone name: cLES-1-G13
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77012 [cLES-1-G13] Trace: SGN-T97276 EST: SGN-E283600 Direction: 3' Facility: TIGR
Clone: SGN-C190108 [TUS-59-I18] Trace: SGN-T340541 EST: SGN-E539666 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190108 [TUS-59-I18] Trace: SGN-T340543 EST: SGN-E539668 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283599Length: 499 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283599 [] (trimmed) AATTGTGAGGTCTCAGCTGTTGTAGTACAGAAATGTCTAAGGATACCTCTCTGCTAAAATATTCAACATTAATCCTCATCTTTCTGCAAACATGC
AATGCTTGGAAGATGAAGCCCGATTACTGTTATCCGAAGACCCCTTCTGCTTGTGGTCATATCCGAGACATCAGCTACCCTTTTCACTTAAACAG
TGACCCAGAAATTTGTGGAGATGATCCGAAATTTGAATTTAGTTGTGAAGATAACCAAACGGTTATGTCGATCCTCTCCAAGAAGCTGTATGTGC
AAGCCATCAACTATAATAGTAAGACAATTCACCTGGTAGATCCAGCTTTACAAACACAAGATGATCTATGCTCTTTCAGTCCTCAGCTTCTGTTC
TTCGACCAATCCGATACAATCTTCCGATCATACTATAGTGGGCTTAGATCAGCAGAGCCCATTTTCATGTTCAACTGTCCATCTGCTGTTAATAG
TTCTTCGACATTTCTGGAAATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283599] SGN-U575324 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97275 [Download] [View] Facility Assigned ID: TPSAA43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5