Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E283654

Search information 
Request: 283654Match: SGN-E283654
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77001Clone name: cLES-1-F23
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283654Length: 418 bp (617 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E283654 [] (trimmed) TTTTGTACATCTTTTAATTACCAAAAAAAAAAGAGGAAGAAGATATGGCTTCTAATACATTGATGAGTTGTGGAATTCCAGCTGTTTGCCCCTCT
TTCCTCTCTTCTACCAAGTCCAAATTCGCCGCCGCGATGCCGGTGTCCGTTGGAGCTACCAACTCCATGTCTCGGTTCTCCATGTCAGCTGATTG
GATGCCCGGGCAGCCCCGTCCATCTTACCTCGACGGCTCAGCCCCCGGAGATTTTGGATTTGATCCACTTGGTTTAGGAGAAGTACCTGCAAATT
TGGAAAGATACAAAGAATCTGAACTTATTCATTGCAGATGGGCTATGCTTGCTGTTCCCGGAATCATAGTACCAGAGGCATTGGGCTACTCTAAA
GACCCTGCTAAATTTGAAGAACTCAAAGTCAAGGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283654] SGN-U590195 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97330 [Download] [View] Facility Assigned ID: TPSAC36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5