EST details — SGN-E283693

Search information 
Request: 283693Match: SGN-E283693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76929Clone name: cLES-1-A5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76929 [cLES-1-A5] Trace: SGN-T97368 EST: SGN-E283692 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283693Length: 536 bp (883 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E283693 [] (trimmed) CAGAAAGAGATTAGTAAAGAAACAAATATCTTTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGA
AAACAAGGGAAAATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAG
AACTTAGTATCCTTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGT
AAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCG
TAGTATCCTGGTGACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTC
AATTTCGCTGAGCAATTGCTCGTCGGACAAATCAAGAAGGTACGACAGAGTCTCGTACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283693] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97369 [Download] [View] Facility Assigned ID: TPSAA03TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5