Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E283730

Search information 
Request: 283730Match: SGN-E283730
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77020Clone name: cLES-1-G7
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77020 [cLES-1-G7] Trace: SGN-T97405 EST: SGN-E283729 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283730Length: 450 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E283730 [] (trimmed) ACTAGACTAAGGATACACAGAAAGTCCATTCCATTAGAAATCTATTAGTACATGGGAGAGTTTTACAAGGTGTTTTTGGCTAATATACTATATGA
TAAATAGTACAATTTAATTAGGGAAAATGCCTTTAGGGATAATAACATCCCCAATGTTGTTGTGCCATGGGTCAGCCAAGTGAGTTGCCAAGTTC
TCCAATGGTCCTGTTCCTGGATATGCTGATTGTTGTACACAAAATCCCACAAATGCCAACAATGCAAGACGACCATTCTTGATTTCCTTGACTTT
GAGTTCTTCAAATTTAGCAGGGTCTTTAGAGTAGCCCAATGGGTCAAAAGCCCCACCAGGGTACTTCTTCTTTTCTGAATCTTTTTCCATACTCC
TTTGGTGTTCTACAAAAGCTATGGCTAGAAATTCAATAGCCAAAATAGTAGGAAGTGTTCCCCATGGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283730] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97406 [Download] [View] Facility Assigned ID: TPSAA40TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5