EST details — SGN-E283943

Search information 
Request: 283943Match: SGN-E283943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70072Clone name: cLER-13-H5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189903 [TUS-59-A5] Trace: SGN-T340191 EST: SGN-E539316 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283943Length: 370 bp (703 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E283943 [] (trimmed) TCAGGATCCAAATCTATATTATGGGGGTTACGCTGGGTATGGAAATTACCCTCCACAGCAGCAACAACCACAGTGATCTCTGCTGGTTAAAGGAG
TCGACGAAAGCTTCCTAGCACAGTAATGCAACGATGTAGAAAGGGAGGGGCATGGATTCGAAGTTTGCATCAGATTTAGTATAAGATAAACTACT
GTAGGCTGGTTCTTGAAGATCAGTATTTATGGTTGTGTTCAACCATCGCTTACTTTTTCATTAGTTACCTTCTGTTATTTTTCATTGGTTTTTTT
GTTGATCTTTTTGGTTTTTGCGCTTTTATGTTTACTTTTCATGAGTCCCACTTGGTACTTGGATTTTTGTTCTAGTTGGTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283943] SGN-U581411 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94637 [Download] [View] Facility Assigned ID: TPRBY39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5