EST details — SGN-E283974

Search information 
Request: 283974Match: SGN-E283974
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69941Clone name: cLER-13-B16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189882 [TUS-58-P8] Trace: SGN-T340152 EST: SGN-E539277 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189882 [TUS-58-P8] Trace: SGN-T340155 EST: SGN-E539280 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283974Length: 499 bp (959 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283974 [] (trimmed) GAAACCCGGGATAAACCCTACGACTGGTGTGACCCTCCTGGATCTGCCCCCAAACGGACCAACAATGGCGACTCAGGAGAAGAGTGAAGTGATTG
AACCACCAACTACAGTAGACAAACAATCAGAAAGTTACTCATACACTACTTGGGCAGGTAAGATACAAGAACAGTACCAGAAAGTGAAAGAGAAT
GCAGAAACCTACCCCTATGTTTGGGGTTCCTATACTGTTGTATACGGAGGATTGGGGCTCTGGTTTGCCTATAGATGGCGAAGGCTCCGCAAAAC
AGAAGACAGAGTTAGAGTCCTTCAAGACAGACTTCGCAAACTTGTGCAAGCTGAAGAGTCGACAAGTTCATCTGTAACCAAAGCACCCTCATCTA
GTGATAAATCAACAAGATAGTTTGTGTTTCTCTTTTCGTTGAAGTTGTGTTTTTATACATTTTGCTTAAAAAATGAGTTACCAATGACTGCAGTT
GGTCACACAATTATCGCGGCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283974] SGN-U582595 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94668 [Download] [View] Facility Assigned ID: TPRBZ08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0176 Quality Trim Threshold: 12.5