EST details — SGN-E284309

Search information 
Request: 284309Match: SGN-E284309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70923Clone name: cLER-16-F16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284309Length: 407 bp (722 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284309 [] (trimmed) TTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAGATAAAGGAGTTGAGGACAAAGGAGATTAAGAACGGTAGACTTGCTATGTTAGCCGTT
ATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGATAACCTATTTGCTCACCTAGCTGATCCTGGTCATGCCACTATTTTTGC
TGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTGTAATGATGTGTAAAAGTAACATTTGAAGTAGATTTGTGCAAAGAAAAAC
TTTAATGTTTCTTTTGCCACTCAATGTAGTATACCTACATTTGGTTTGCCCTCCTGTAGAAAAAGACTCAGTGTACAAATACCTTTGAGAATTCG
TGTCAGATCAAAAAAATCTATTTATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284309] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95582 [Download] [View] Facility Assigned ID: TPRCL32THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5