EST details — SGN-E284363

Search information 
Request: 284363Match: SGN-E284363
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70989Clone name: cLER-16-I21
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284363Length: 276 bp (740 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284363 [] (trimmed) CTACAATGGCTCTTTCTTCTCCTTCTTTTGCCGGACAGGCAGTGAAACTCTCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATG
AGAAAGGCTGTTGCCAAGTCTGCCCCATCTAGCAGTCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAG
CTACTTGACTGGTGAATTCCCTGGTGACTACGGCTGGGATACCGCTGGACTCTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284363] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95636 [Download] [View] Facility Assigned ID: TPRCI59THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5