Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E284420

Search information 
Request: 284420Match: SGN-E284420
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70886Clone name: cLER-16-D19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284420Length: 537 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284420 [] (trimmed) CCGGAATCATAGTACCAGAGGCATTGGGCTTAGGTAATTGGGTCAAGGCCCAAGAATGGGCAGCCATTCCTGGTGGACAAGCTACATATTTGGGC
CAGCCTGTTCCATGGGGAACACTTCCTACTATTTTGGCTATTGAATTTCTAGCCATAGCTTTTGTAGAACACCAAAGGAGTATGGAAAAAGATTC
AGAAAAGAAGAAGTACCCTGGTGGGGCTTTTGACCCATTGGGCTACTCTAAAGACCCTGCTAAATTTGAAGAACTCAAAGTCAAGGAAATCAAGA
ATGGTCGTCTTGCATTGTTGGCATTTGTGGGATTTTGTGTACAACAATCAGCATATCCAGGAACAGGACCATTGGAGAACTTGGCAACTCACTTG
GCTGACCCATGGCACAACAACATTGGGGATGTTATTATCCCTAAAGGCATTTTCCCTAATTAAATTGTACTATTTATCATATAGTATATTAGCCA
AAAACACCTTGTAAAACTCTCCCATGTACTAATAGATTTCTAATGGAATGGACTTTCTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284420] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95693 [Download] [View] Facility Assigned ID: TPRCK22THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0016 Quality Trim Threshold: 12.5