EST details — SGN-E285175

Search information 
Request: 285175Match: SGN-E285175
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72397Clone name: cLER-20-B1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190058 [TUS-59-G16] Trace: SGN-T340455 EST: SGN-E539580 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190058 [TUS-59-G16] Trace: SGN-T340457 EST: SGN-E539582 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285175Length: 337 bp (862 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285175 [] (trimmed) GATAACCAGGGATTCGTACTGGGGAATGATGGTGTCTTACTGAAGTATCTTGGATAGAAACAATTGTTAAACAAGGCAATTTTGGAAGCAAATAC
TTGAAACTGAACTACTGTAATTTAATCTATAAACACTTGTAAAATTCTTTGCTGATTATTCTTTGCTGATTATCACCATACCTAAGGGAAGTGTT
CATAGGGCTTGAGATTTTAGATTATCTAATGAAAATATATCAGACTTACACGTTATCATGGAGATGACGTTTTGAAATGTGTTATGATATACCAA
AACATTTCAAACAAATTAAACTTTGATGAGATGAGACATATCTTGGCTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285175] SGN-U578041 Tomato 200607 Build 2 57 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96747 [Download] [View] Facility Assigned ID: TPRDA01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5