EST details — SGN-E285182

Search information 
Request: 285182Match: SGN-E285182
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72458Clone name: cLER-20-D7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285182Length: 579 bp (856 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E285182 [] (trimmed) CAGCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAG
TCCACCGCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCC
ACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAACGAAATTGAGTACCTATTGAAAAATG
GATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACC
ATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCG
TATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACTAATTGCCC
TATGTTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285182] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96754 [Download] [View] Facility Assigned ID: TPRDA16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0118 Quality Trim Threshold: 12.5