EST details — SGN-E286046
| Search information |
| Request: 286046 | Match: SGN-E286046 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C75284 | Clone name: cLES-13-I11 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C190448 [TUS-60-G22] | Trace: SGN-T341125 | EST: SGN-E540250 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C190448 [TUS-60-G22] | Trace: SGN-T341127 | EST: SGN-E540252 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E286046 | Length: 158 bp (236 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E286046 [] (trimmed)
CACAAATTTTCCGGCGATGTCTACGGAAACAGCCGCCAATGATAACATACCTAACGCCGATGTTAGCCCAAGCAACGGTGTCGGAATTGATACGA
CGCCGTTTCTCACTAGCCAGAATTCCAGGAGCCGACGTTCGTTCCGTCGCCCTCCGAGCCTCA
CGCCGTTTCTCACTAGCCAGAATTCCAGGAGCCGACGTTCGTTCCGTCGCCCTCCGAGCCTCA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E286046] | SGN-U582128 | Tomato 200607 | Build 2 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T100359 [Download] [View] | Facility Assigned ID: TPSBW54TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.946 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 14.5 |
Working
