Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E286142

Search information 
Request: 286142Match: SGN-E286142
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75188Clone name: cLES-13-D10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190429 [TUS-60-G3] Trace: SGN-T341092 EST: SGN-E540217 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190429 [TUS-60-G3] Trace: SGN-T341095 EST: SGN-E540220 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286142Length: 485 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286142 [] (trimmed) GCGTCATTCAGTATAGCGTAGACCACGAATGACACAGGTTCTCCGAGCCTTGGAAGGAGATGTCTCATTATCGGACCTTAACGAAGGGATTAAAC
CTGGACACAGCACAGTATACAGTTCATATACAAGTTCAGATTACGACACACTTCAATACAACGAAGACATGAAGAAATTCAGGAAGATGGCACTC
GCGACAAGTCAAGAATATGCCAGCAGTGATCAGTACAGTAATCCAACGAGCGAATATGGACTAAACCCGTCTGGATCAAGTAGCGAAGGCCATCA
AACTGCGGAAATGGAAACGGGTCGGATGAGAAAAGACAGCAGAGGATTCAGTGGAAGTAAAGGCTTCAGTGGAACTTCTTAGTACACAAGAAACT
CCATTTCTGTATAGTCTTTTCAACCTCTAACTCTTTTATAACATGAATGCTTCCACAATGATGATTTATTTTGGTCAATATACAGATTTTTTTTT
CCCCTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286142] SGN-U582338 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100455 [Download] [View] Facility Assigned ID: TPSBZ17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0054 Quality Trim Threshold: 12.5