EST details — SGN-E286305

Search information 
Request: 286305Match: SGN-E286305
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74903Clone name: cLES-11-P8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286305Length: 473 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E286305 [] (trimmed) TCAAAATGAAGCAAAAGGTTGTTATTAGACTATCTTTAAATGGAAACGGTCAGAAAGATCGAACCAAGGCCTTCAAAATTGCTGTTTCTCAATCA
GGCGTAGAATCAGCAGCTATAACAGGAGACGGAAAGAATCAACTCGAAGTTGTGGGAGAAGTAGACGCTGCGACTCTAACGAGCTTATTGAGGAA
GAATTTGGGCCAGGCGGACTTGGTTAGCGTTGGCCCGGCTGGTGGCGATAAAAAACCCGCAGCTCCAGCTCCAGCTCCGGCTGCAGCTGCAGCTG
CGGTGGTACAATCGCAGCCCGACTCGTATTACTATGTTTATCCGCCTTATCAATACCCTGTTTACCAAGTTACAGATTCTTATGGTCAATCGAAT
TGTTCCATTATGTGAAGAACAGGGAGATCCAAGATATAATAAAATTGTATTCACCGTCAAATATTTATTGATATGTTAGATAGATATTAGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286305] SGN-U584433 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99836 [Download] [View] Facility Assigned ID: TPSBR88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5