EST details — SGN-E286883

Search information 
Request: 286883Match: SGN-E286883
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75535Clone name: cLES-14-H20
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190481 [TUS-60-I7] Trace: SGN-T341181 EST: SGN-E540306 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190481 [TUS-60-I7] Trace: SGN-T341184 EST: SGN-E540309 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286883Length: 430 bp (821 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286883 [] (trimmed) TTTTCGAGCTAACGGACGATTGTCGCCGTCGTTGAAGTAGAAAAGATGACCAATTACCGGCCATCCTCCGGCAATTTCCGGTGGTAATGGTAGTT
TTGACGATTTTTTTGTCGATAGGATGAAGTAGAAGAGGAATGCGAGTGTTAACAGTGCGACAATGGCGGCTTCCATGGGAGAAAGAAGAAGAAGA
AGAAGATCAAATTTCATGTTTAGAAAGTTATTATGAGTATTGACGTACAATTATGATGCATGGAACTTGTTTTTATAGTGTCAACCTTCGATTCT
TCAGTTCGATTTAATTAAATTTTGATTCAATTTTTAGAAAAGTTGCATCATATTTCAAATCAAATTAAATCGCTTCGTTTTGGTTTTTTCTACTT
CGGTTCAATTTAATTCAATGTAGTTAAATCAATTTTTCGGTGTAAATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286883] SGN-U582132 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100704 [Download] [View] Facility Assigned ID: TPSCD46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5